Stem-loop sequence mmu-mir-6342

AccessionMI0021870 (change log)
Symbol MGI:Mir6342
DescriptionMus musculus miR-6342 stem-loop
Stem-loop
   c     u     c  a  -g a      ucca          g ---u    ---   aa   ugg 
5'  uucga ggagc ug gu  g cagauc    gagaggaucc c    auca   ugc  cug   c
    ||||| ||||| || ||  | ||||||    |||||||||| |    ||||   |||  |||    
3'  gaguu ccuug ac ca  c gucugg    uuuucuuagg g    uggu   acg  gac   a
   a     u     -  a  ga -      uaaa          a uuuc    cua   ac   uga 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 29421488-29421612 [+]
intergenic
Database links

Mature sequence mmu-miR-6342

Accession MIMAT0025085
Sequence

65 - 

cagcagcaaucuggucuuugag

 - 86

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).