Stem-loop sequence mmu-mir-133c

AccessionMI0021863 (change log)
Symbol MGI:Mir133c
DescriptionMus musculus miR-133c stem-loop
Literature search

141 open access papers mention mmu-mir-133c
(610 sentences)

Stem-loop
   ---a     -a     -ac      -g     aucc     a 
5'     ggcuc  ugaag   accaaa  gagac    ccagc g
       |||||  |||||   ||||||  |||||    ||||| u
3'     cugag  acuuc   ugguuu  cuuug    ggucg c
   ggga     ga     ccc      ga     -guc     g 
Get sequence
Deep sequencing
683 reads, 61.8 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 29475215-29475294 [-]
antisense
OTTMUST00000086748 ; Med27-005; intron 3
OTTMUST00000086751 ; Med27-008; intron 3
OTTMUST00000028055 ; Med27-003; intron 3
OTTMUST00000027868 ; Med27-001; intron 4
OTTMUST00000028053 ; Med27-002; intron 4
OTTMUST00000086749 ; Med27-006; intron 4
OTTMUST00000086750 ; Med27-007; intron 4
OTTMUST00000086752 ; Med27-009; intron 5
ENSMUST00000162597 ; Med27-005; intron 3
ENSMUST00000159280 ; Med27-008; intron 3
ENSMUST00000123522 ; Med27-003; intron 3
ENSMUST00000028139 ; Med27-001; intron 4
ENSMUST00000113830 ; Med27-002; intron 4
ENSMUST00000162603 ; Med27-006; intron 4
ENSMUST00000162623 ; Med27-007; intron 4
ENSMUST00000159034 ; Med27-009; intron 5
Database links

Mature sequence mmu-miR-133c

Accession MIMAT0025078
Sequence

56 - 

uuugguccccuucaaggagucag

 - 78

Get sequence
Deep sequencing669 reads, 25 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).