Stem-loop sequence mmu-mir-195b

AccessionMI0021861 (change log)
Symbol MGI:Mir195b
DescriptionMus musculus miR-195b stem-loop
Literature search

94 open access papers mention mmu-mir-195b
(403 sentences)

Stem-loop
   a         uaa   g   -c    aaau     -  aa  c    c  c 
5'  gaaaggacu   aua cag  acag    aguag aa  ca agcc aa a
    |||||||||   ||| |||  ||||    ||||| ||  || |||| ||  
3'  uuuuucuga   uau guc  uguc    ucguc uu  gu ucgg uu g
   c         ---   a   aa    -cuc     a  aa  -    u  c 
Get sequence
Deep sequencing
64127 reads, 605 reads per million, 105 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 56785811-56785907 [+]
intergenic
Database links

Mature sequence mmu-miR-195b

Accession MIMAT0025076
Sequence

15 - 

uagcagcacagaaauaguagaa

 - 36

Get sequence
Deep sequencing64121 reads, 104 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).