Stem-loop sequence rno-mir-6332

AccessionMI0021858 (change log)
DescriptionRattus norvegicus miR-6332 stem-loop
Stem-loop 
   -----uaac      cuu        cgg  -   cauua       -a  a             c 
5'          ccaggu   gguugcca   cu ucu     gcuccuu  ag ucccuguggagca u
            ||||||   ||||||||   || |||     |||||||  || ||||||||||||| g
3'          gguucg   ucgacggu   ga agg     cgaggaa  uc agggacgccucgu g
   cucucguca      ---        --a  c   -acgc       cg  -             u
Get sequence
Deep sequencing
27 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 167402968-167403088 [+]
sense
ENSRNOT00000024443 ; Rere-201; intron 1
Database links

Mature sequence rno-miR-6332

Accession MIMAT0025073
Sequence

69 -  

cgcagggacugcaaggagccgca

 - 91

Get sequence
Deep sequencing15 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).