Stem-loop sequence rno-mir-679

AccessionMI0021857 (change log)
DescriptionRattus norvegicus miR-679 stem-loop
Gene family MIPF0001564; mir-679
Stem-loop
   ------      g    g  -   -a   -  c   c       uuga         -u   u    g  ---u  g 
5'       gucccu uggu ac uug  ggc ug ucc uguggcu    acugugagg  gac cuug ug    gu a
         |||||| |||| || |||  ||| || ||| |||||||    |||||||||  ||| |||| ||    ||  
3'       caggga guca ug aac  ccg ac agg auaccga    ugacacucc  cug gaac ac    cg u
   ugguga      a    g  c   ga   c  -   a       ----         uu   -    g  uuuu  g 
Get sequence
Deep sequencing
256 reads, 0 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133864564-133864700 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-679
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
Database links

Mature sequence rno-miR-679

Accession MIMAT0025072
Sequence

77 - 

caaggucuuccucacaguagc

 - 97

Get sequence
Deep sequencing18 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).