![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hme-mir-9b |
|||||
Accession | MI0021799 (change log) | ||||
Description | Heliconius melpomene miR-9b stem-loop | ||||
Gene family | MIPF0000014; mir-9 | ||||
Stem-loop |
aucagcgacucgucuaccgaca aa u uu g - au 5' ggcu uua cuuuggu ucuagcu uauga gu u |||| ||| ||||||| ||||||| ||||| || 3' ccgg aau gaggcca ggaucga auacu ca g -------------uaguuucug -g u uu a a ga |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hme-miR-9b |
|
Accession | MIMAT0025002 |
Sequence |
32 - ucuuugguuuucuagcuguaug - 53 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species"
Nature 2012 [Epub ahead of print].
|
2 |
PMID:22722851
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species"
Nature. 487:94-98(2012).
|