Stem-loop sequence hme-mir-9b

AccessionMI0021799 (change log)
DescriptionHeliconius melpomene miR-9b stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   aucagcgacucgucuaccgaca    aa   u       uu       g     -  au 
5'                       ggcu  uua cuuuggu  ucuagcu uauga gu  u
                         ||||  ||| |||||||  ||||||| ||||| ||   
3'                       ccgg  aau gaggcca  ggaucga auacu ca  g
   -------------uaguuucug    -g   u       uu       a     a  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670875: 766546-766650 [+]
intergenic
Database links

Mature sequence hme-miR-9b

Accession MIMAT0025002
Sequence

32 - 

ucuuugguuuucuagcuguaug

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).