Stem-loop sequence hme-mir-998

AccessionMI0021798 (change log)
DescriptionHeliconius melpomene miR-998 stem-loop
Gene family MIPF0000952; mir-998
Stem-loop
   -------ggggcaaagggccaguguggca  -  g  u   c     ac         g   c  -  c 
5'                              cg gg cg ccc gagcu  aucccgugg gcu ca gu u
                                || || || ||| |||||  ||||||||| ||| || ||  
3'                              gc cc gc ggg cucga  uaggguacc cga gu cg g
   uuccagcaaacuacaaucaucuacaauca  g  g  -   a     cu         a   u  g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE672080: 325219-325348 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-998
hme-mir-11HE672080: 326718-326847 [-]
hme-mir-998HE672080: 325219-325348 [-]
Database links

Mature sequence hme-miR-998

Accession MIMAT0025001
Sequence

69 - 

uagcaccaugggauucagcuca

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).