Stem-loop sequence hme-mir-971

AccessionMI0021795 (change log)
DescriptionHeliconius melpomene miR-971 stem-loop
Gene family MIPF0000995; mir-971
Stem-loop
      ag     ac   c     c    uau           guauu 
5' gua  gagcg  cgg ucacu uaag   gaacgccaagc     g
   |||  |||||  ||| ||||| ||||   |||||||||||      
3' uau  cuugc  guc aguga auuc   cuugugguucg     c
      cu     au   a     c    cau           aaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670834: 76879-76970 [+]
intergenic
Database links

Mature sequence hme-miR-971

Accession MIMAT0024998
Sequence

55 - 

uugguguucuaccuuacagugaa

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).