Stem-loop sequence hme-mir-965

AccessionMI0021793 (change log)
DescriptionHeliconius melpomene miR-965 stem-loop
Gene family MIPF0000708; mir-965
Stem-loop
       uc     ua  c        ug ac             g    guau       
5' gaug  cauuu  ug uguauaac  a  gggagaaguuaua cgcu    guuaug 
   ||||  |||||  || ||||||||  |  ||||||||||||| ||||    ||||| u
3' cuac  guaaa  ac acauguug  u  cccuuuucgauau gcga    cgauau 
       --     --  a        gu -c             -    auac       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670498: 371711-371819 [-]
intergenic
Database links

Mature sequence hme-miR-965

Accession MIMAT0024996
Sequence

67 - 

uaagcguauagcuuuuccccuu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).