Stem-loop sequence hme-mir-932

AccessionMI0021792 (change log)
DescriptionHeliconius melpomene miR-932 stem-loop
Gene family MIPF0000588; mir-932
Stem-loop
   ---gggaaaaaggcaaagga     c   ga       a       g   a      --u  a 
5'                     aaggg gcc  ggccuca uuccgua ugc uugcag   gc u
                       ||||| |||  ||||||| ||||||| ||| ||||||   || a
3'                     uuccu ugg  ucggagu aaggcgu acg aacguc   cg u
   ccacacaacuaugcaacgaa     c   ag       g       g   -      ccc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670498: 24439-24561 [+]
intergenic
Database links

Mature sequence hme-miR-932

Accession MIMAT0024995
Sequence

33 - 

ucaauuccguagugcauugcagu

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).