Stem-loop sequence hme-mir-92b

AccessionMI0021791 (change log)
DescriptionHeliconius melpomene miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
      c     ---u   c   g u    a  ca    a  u    c       acgu    au 
5' ggc ggucg    uca agc g ggcc cg  uagg cg gauu gguguaa    ugug  c
   ||| |||||    ||| ||| | |||| ||  |||| || |||| |||||||    ||||  c
3' ucg cuagu    ggu ucg c ccgg gc  gucc gc cuaa ccacguu    acac  u
      a     cgau   c   g u    c  ac    g  c    -       ----    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE672043: 129043-129161 [+]
intergenic
Clustered miRNAs
< 10kb from hme-mir-92b
hme-mir-92aHE672043: 128895-129018 [+]
hme-mir-92bHE672043: 129043-129161 [+]
Database links

Mature sequence hme-miR-92b

Accession MIMAT0024994
Sequence

67 - 

cauugcaccaaucccggccugc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).