Stem-loop sequence hme-mir-8

AccessionMI0021785 (change log)
DescriptionHeliconius melpomene miR-8 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
         g   uu  -      -   g     c       ucuua 
5' ggagug cgg  cg caucuu acc ggcag auuagag     c
   |||||| |||  || |||||| ||| ||||| |||||||     c
3' ccucgc gcc  gc guagaa ugg cuguc uaaucuu     g
         -   -u  u      a   a     a       uuauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670477: 58586-58672 [+]
intergenic
Database links

Mature sequence hme-miR-8

Accession MIMAT0024988
Sequence

54 - 

uaauacugucagguaaagaugu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).