Stem-loop sequence hme-mir-7

AccessionMI0021781 (change log)
DescriptionHeliconius melpomene miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   uccacgugacuaacagcgauc    -u   g     u   a  c         u      ugaua 
5'                      ugcc  cgc uugua gga ga uagugauuu guuguu     a
                        ||||  ||| ||||| ||| || ||||||||| ||||||     u
3'                      acgg  gcg aacau ccu cu aucacuaaa uaacaa     a
   ----------aggcuucuccc    uc   a     c   -  a         -      uauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670618: 34385-34504 [-]
intergenic
Database links

Mature sequence hme-miR-7

Accession MIMAT0024984
Sequence

36 - 

uggaagacuagugauuuuguug

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).