Stem-loop sequence hme-mir-34-2

AccessionMI0021780 (change log)
DescriptionHeliconius melpomene miR-34-2 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   gcacaagacagaagagcagaagcau       c a   u       ug    g         ua  c 
5'                          ggguagg c cag ggcagug  guua cugguuguu  gu a
                            ||||||| | ||| |||||||  |||| |||||||||  ||  
3'                          uccguuc g guc ccgucac  caau gaccgacaa  cg c
   --------------------cgaag       u c   u       cg    -         --  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE669997: 8000-8112 [+]
intergenic
Database links

Mature sequence hme-miR-34

Accession MIMAT0024983
Sequence

39 - 

uggcagugugguuagcugguug

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).