Stem-loop sequence hme-mir-3338

AccessionMI0021778 (change log)
DescriptionHeliconius melpomene miR-3338 stem-loop
Gene family MIPF0001449; mir-3338
Stem-loop
   ------------uuggacaaaauuauaagaau      u        c     u     a   -  a u 
5'                                 guuuca agcaaaca aguag guaca ugc ua g u
                                   |||||| |||||||| ||||| ||||| ||| || |  
3'                                 uaaggu uuguuugu ucauu caugu acg au c g
   aauccguaagagguucaacaucgaauuucuuc      c        u     -     -   c  a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671311: 86489-86613 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-3338
hme-mir-3338HE671311: 86489-86613 [-]
hme-mir-3327HE671311: 86365-86480 [-]
Database links

Mature sequence hme-miR-3338

Accession MIMAT0024982
Sequence

67 - 

auguacuuacuuuguuuguucu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).