Stem-loop sequence hme-mir-33-1

AccessionMI0021775 (change log)
DescriptionHeliconius melpomene miR-33-1 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   -    aca     uu      -g   a      uu c       u  uua 
5'  gaag   aacua  gcgaga  ugc uuguag  g auugcac ug   u
    ||||   |||||  ||||||  ||| ||||||  | ||||||| ||    
3'  uuuc   uugau  cgcucu  acg aacauc  u uaacgug au   u
   c    --g     cu      aa   a      uu a       u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670818: 67928-68025 [+]
intergenic
Database links

Mature sequence hme-miR-33

Accession MIMAT0024980
Sequence

21 - 

gugcauuguaguugcauugcac

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).