Stem-loop sequence hme-mir-3286

AccessionMI0021774 (change log)
DescriptionHeliconius melpomene miR-3286 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   --------------------gagac     -  -aa  c         -u   u        --c     a 
5'                          gaagc cc   aa aacuauugg  cac gcacagga   uagua c
                            ||||| ||   || |||||||||  ||| ||||||||   |||||  
3'                          cuucg gg   uu uugauaacc  gug cguguucu   auuau c
   cucuauaagcgagaagcuacuaaua     u  gug  a         uu   -        cau     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670563: 208603-208720 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-3286
hme-mir-210HE670563: 209719-209837 [+]
hme-mir-3286HE670563: 208603-208720 [-]
Database links

Mature sequence hme-miR-3286

Accession MIMAT0024979
Sequence

60 - 

uugugcguguuccaauaguuau

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).