Stem-loop sequence hme-mir-308

AccessionMI0021772 (change log)
DescriptionHeliconius melpomene miR-308 stem-loop
Gene family MIPF0000171; mir-308
Literature search

1 open access papers mention hme-mir-308
(1 sentences)

Stem-loop
   gcuacgagggaccacaguaacuca   u    u    a    a      u       au    u 
5'                         gcg cgcg ccac cgcg uauuau ccuguga  uugu a
                           ||| |||| |||| |||| |||||| |||||||  |||| g
3'                         cgc gcgu ggug gcgu auaaua ggacacu  aaca u
   cgcgucucaucacuagcuacucug   u    c    a    c      -       --    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE669504: 9953-10080 [+]
intergenic
Database links

Mature sequence hme-miR-308

Accession MIMAT0024977
Sequence

71 - 

aaucacaggauaauacugcgag

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).