Stem-loop sequence hme-mir-307

AccessionMI0021771 (change log)
DescriptionHeliconius melpomene miR-307 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
         aa   -      uc   cua         ccu  g       u  ---   c 
5' aaugug  aug cucauu  cgg   cucacucaa   gg ugugaug gu   gca u
   ||||||  ||| ||||||  |||   |||||||||   || ||||||| ||   ||| c
3' uuacau  uac gggugg  gcc   gagugaguu   cc acacuac cg   cgu g
         -c   a      gu   agc         ccu  a       c  gcu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671244: 79034-79147 [-]
intergenic
Database links

Mature sequence hme-miR-307

Accession MIMAT0024976
Sequence

71 - 

cacaaccuccuugagugagcga

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).