Stem-loop sequence hme-mir-2c

AccessionMI0021768 (change log)
DescriptionHeliconius melpomene miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
       -      -c   --cg   -a     uag    c        -         a    ucu 
5' ucac uaggaa  ugu    aag  gcaau   ggag cgacaaag ugguugugg augu   a
   |||| ||||||  |||    |||  |||||   |||| |||||||| ||||||||| ||||   u
3' agug guccuu  acg    uuc  cguug   cuuc guuguuuc accgacacu uacg   a
       c      aa   ucga   ac     uua    a        g         a    ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671256: 345000-345124 [+]
intergenic
Clustered miRNAs
< 10kb from hme-mir-2c
hme-mir-71HE671256: 336011-336095 [+]
hme-mir-2aHE671256: 344456-344564 [+]
hme-mir-13aHE671256: 344603-344728 [+]
hme-mir-13bHE671256: 344758-344850 [+]
hme-mir-2bHE671256: 344866-344971 [+]
hme-mir-2cHE671256: 345000-345124 [+]
Database links

Mature sequence hme-miR-2c

Accession MIMAT0024973
Sequence

68 - 

uaucacagccagcuuuguugacu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).