Stem-loop sequence hme-mir-2b

AccessionMI0021767 (change log)
DescriptionHeliconius melpomene miR-2b stem-loop
Gene family MIPF0000049; mir-2
   gccgguauagucaucgggcag     g    a    -     -       a     ucu 
5'                      gucga uguc cuca cgaag ugguugu guaug   c
                        ||||| |||| |||| ||||| ||||||| |||||   c
3'                      cgguu acag gagu guuuc accgaca uauac   a
   -------------cggucaag     a    c    a     g       c     cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671256: 344866-344971 [+]
Clustered miRNAs
< 10kb from hme-mir-2b
hme-mir-71HE671256: 336011-336095 [+]
hme-mir-2aHE671256: 344456-344564 [+]
hme-mir-13aHE671256: 344603-344728 [+]
hme-mir-13bHE671256: 344758-344850 [+]
hme-mir-2bHE671256: 344866-344971 [+]
hme-mir-2cHE671256: 345000-345124 [+]
Database links

Mature sequence hme-miR-2b

Accession MIMAT0024972

66 - 


 - 88

Get sequence
Evidence experimental; Illumina [1]


"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).