Stem-loop sequence hme-mir-2a

AccessionMI0021766 (change log)
DescriptionHeliconius melpomene miR-2a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   ---gau  c  c  u     ug   c  -          c    u  c    aucac 
5'       gu ug ac gaaug  guc ug ucaucaaagu gguu gu auag     c
         || || || |||||  ||| || |||||||||| |||| || ||||      
3'       ca ac ug uuuac  cag ac aguaguuucg ccga ca uauc     a
   cuauac  c  -  -     gu   c  g          a    -  c    aaugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671256: 344456-344564 [+]
intergenic
Clustered miRNAs
< 10kb from hme-mir-2a
hme-mir-71HE671256: 336011-336095 [+]
hme-mir-2aHE671256: 344456-344564 [+]
hme-mir-13aHE671256: 344603-344728 [+]
hme-mir-13bHE671256: 344758-344850 [+]
hme-mir-2bHE671256: 344866-344971 [+]
hme-mir-2cHE671256: 345000-345124 [+]
Database links

Mature sequence hme-miR-2a

Accession MIMAT0024971
Sequence

62 - 

uaucacagccagcuuugaugagc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).