Stem-loop sequence hme-mir-279c

AccessionMI0021761 (change log)
DescriptionHeliconius melpomene miR-279c stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
      --u    --     u       u    a          uu    gu      uua 
5' gca   gagu  gugag gacagcu cgga gaugggugaa  ucua  gucaag   c
   |||   ||||  ||||| ||||||| |||| ||||||||||  ||||  ||||||   g
3' ugu   uucg  cauuu cugucgg guuu cuauucacuu  agau  caguuc   g
      uuu    uc     -       c    c          uu    --      caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671887: 111947-112058 [+]
intergenic
Database links

Mature sequence hme-miR-279c

Accession MIMAT0024966
Sequence

63 - 

ugacuagauuuucacuuauccu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).