Stem-loop sequence hme-mir-279d

AccessionMI0021760 (change log)
DescriptionHeliconius melpomene miR-279d stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   gua    u  c      aucu   ug       u  cu      u    ucaaa 
5'    gauu ga uugaug    uug  ggcgagu ug  ucuggu caug     u
      |||| || ||||||    |||  ||||||| ||  |||||| ||||      
3'    cuaa cu aacuac    gac  cugcuca ac  agauca guac     u
   caa    -  c      ---c   gu       u  cu      -    uacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670979: 4634-4738 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-279d
hme-mir-279bHE670979: 5099-5212 [-]
hme-mir-279dHE670979: 4634-4738 [-]
Database links

Mature sequence hme-miR-279d

Accession MIMAT0024965
Sequence

64 - 

ugacuagauccauacucgucug

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).