Stem-loop sequence hme-mir-279b

AccessionMI0021759 (change log)
DescriptionHeliconius melpomene miR-279b stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   cuugaagauaauuggaaaaau       u            a  ag    gu       ug 
5'                      uuugcaa caguuaaugggu ua  ucua  gucacag  u
                        ||||||| |||||||||||| ||  ||||  |||||||  g
3'                      aaacguu guuaguuacuca au  agau  caguguu  c
   ---------gaacuucuaaac       c            c  cu    --       ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670979: 5099-5212 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-279b
hme-mir-279bHE670979: 5099-5212 [-]
hme-mir-279dHE670979: 4634-4738 [-]
Database links

Mature sequence hme-miR-279b

Accession MIMAT0024964
Sequence

70 - 

ugacuagaucuacacucauuga

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).