Stem-loop sequence hme-mir-2796

AccessionMI0021757 (change log)
DescriptionHeliconius melpomene miR-2796 stem-loop
Gene family MIPF0001057; mir-2796
Stem-loop
   gaaca           u    -       u       u   -  g 
5'      gagcacuauca cagg gguuucu ucggccu cag cu u
        ||||||||||| |||| ||||||| ||||||| ||| ||  
3'      cuugugguagu guuc ucaaagg ggccgga guc ga u
   cuauc           c    a       c       u   a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671853: 29993-30082 [+]
intergenic
Database links

Mature sequence hme-miR-2796

Accession MIMAT0024962
Sequence

52 - 

guaggccggcggaaacuacuugc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).