Stem-loop sequence hme-mir-279a

AccessionMI0021756 (change log)
DescriptionHeliconius melpomene miR-279a stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   ---------ugcggccgccgccaaaggu        uuc        ga        g    uuu 
5'                             caauuucu   gaugagug  gguuuagu caug   c
                               ||||||||   ||||||||  |||||||| ||||   c
3'                             guugaagg   cuacucac  cuagauca guac   a
   gcgcaggaacaccggagcugcuuguagc        uac        ac        -    uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE668381: 19300-19422 [-]
intergenic
Database links

Mature sequence hme-miR-279a

Accession MIMAT0024961
Sequence

65 - 

ugacuagauccacacucaucca

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).