Stem-loop sequence hme-mir-1a

AccessionMI0021741 (change log)
DescriptionHeliconius melpomene miR-1a stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
          ua    g             c    uuc     guauu 
5' cauagcc  gcgc aguuccgugcuuc uuac   ccaua     u
   |||||||  |||| ||||||||||||| ||||   |||||     g
3' guauugg  cgcg ucgagguaugaag aaug   gguau     a
          --    -             a    uaa     acuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE672073: 1166261-1166350 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-1a
hme-mir-1aHE672073: 1166261-1166350 [-]
hme-mir-1bHE672073: 1166256-1166357 [+]
Database links

Mature sequence hme-miR-1a

Accession MIMAT0024946
Sequence

56 - 

uggaauguaaagaaguauggag

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).