Stem-loop sequence hme-mir-13b

AccessionMI0021736 (change log)
DescriptionHeliconius melpomene miR-13b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
        ----    ug     -     -             cc    ua 
5' gagag    ucug  gccca uucgu aaaaauggcugug  augg  c
   |||||    ||||  ||||| ||||| |||||||||||||  ||||  a
3' cucuu    gggc  cgggu gagca uuuuuaccgacac  uacu  u
        gacg    gu     u     g             ua    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671256: 344758-344850 [+]
intergenic
Clustered miRNAs
< 10kb from hme-mir-13b
hme-mir-71HE671256: 336011-336095 [+]
hme-mir-2aHE671256: 344456-344564 [+]
hme-mir-13aHE671256: 344603-344728 [+]
hme-mir-13bHE671256: 344758-344850 [+]
hme-mir-2bHE671256: 344866-344971 [+]
hme-mir-2cHE671256: 345000-345124 [+]
Database links

Mature sequence hme-miR-13b

Accession MIMAT0024941
Sequence

51 - 

uaucacagccauuuuugacgagu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).