Stem-loop sequence hme-mir-13a

AccessionMI0021735 (change log)
DescriptionHeliconius melpomene miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
     a   aaaauauuuguau       --g   ua   -        a   g    a   uccuu 
5' cc cuc             guuuucg   gcc  gcc ugucaaag ggc guga aug     u
   || |||             |||||||   |||  ||| |||||||| ||| |||| |||      
3' gg gag             cagaggc   ugg  ugg guaguuuc ccg cacu uac     u
     a   cuaugcgauucac       auu   -c   u        a   a    a   uuccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE671256: 344603-344728 [+]
intergenic
Clustered miRNAs
< 10kb from hme-mir-13a
hme-mir-71HE671256: 336011-336095 [+]
hme-mir-2aHE671256: 344456-344564 [+]
hme-mir-13aHE671256: 344603-344728 [+]
hme-mir-13bHE671256: 344758-344850 [+]
hme-mir-2bHE671256: 344866-344971 [+]
hme-mir-2cHE671256: 345000-345124 [+]
Database links

Mature sequence hme-miR-13a

Accession MIMAT0024940
Sequence

71 - 

uaucacagccacuuugaugug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).