Stem-loop sequence hme-mir-124

AccessionMI0021732 (change log)
DescriptionHeliconius melpomene miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
        -uuaagaacac     ac   cuc            ca   a    -  uuc 
5' gagca           agucc  cuc   gcguucacugcg  gcc uaug ug   c
   |||||           |||||  |||   ||||||||||||  ||| |||| ||    
3' cucgu           ucggg  gag   cguaaguggcgc  cgg auac ac   u
        uagccgcgaac     -c   aac            -a   a    u  cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE672073: 380424-380535 [+]
intergenic
Database links

Mature sequence hme-miR-124

Accession MIMAT0024937
Sequence

66 - 

uaaggcacgcggugaaugccaa

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).