Stem-loop sequence hme-mir-11

AccessionMI0021729 (change log)
DescriptionHeliconius melpomene miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
   gcg    gg   ----     g --uc        cc        u    gc       ca    uug 
5'    uccu  cug    gcugc g    accgcguc  guggcuag acuc  gcuguga  ugug   c
      ||||  |||    ||||| |    ||||||||  |||||||| ||||  |||||||  ||||    
3'    gggg  gau    uggcg c    uggcgcgg  uaucgauc ugag  ugacacu  acac   c
   caa    aa   auca     g uacu        ca        u    ac       --    cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE672080: 326718-326847 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-11
hme-mir-11HE672080: 326718-326847 [-]
hme-mir-998HE672080: 325219-325348 [-]
Database links

Mature sequence hme-miR-11

Accession MIMAT0024934
Sequence

70 - 

caucacagucagaguucuagcu

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).