Stem-loop sequence hme-mir-10

AccessionMI0021727 (change log)
DescriptionHeliconius melpomene miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention hme-mir-10
(1 sentences)

Stem-loop
       c      cu   -  g    u           ugaa 
5' gugc cuacau  acc cu uaga ccgaauuuguu    g
   |||| ||||||  ||| || |||| |||||||||||    u
3' uacg ggugug  ugg ga aucu ggcuuaaacag    g
       u      uu   a  g    u           cgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE667778: 152714-152795 [-]
intergenic
Database links

Mature sequence hme-miR-10

Accession MIMAT0024932
Sequence

14 - 

acccuguagauccgaauuuguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).