Stem-loop sequence hme-let-7

AccessionMI0021726 (change log)
DescriptionHeliconius melpomene let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention hme-let-7
(2 sentences)

Stem-loop
        gg  cac    c    g   u   g                a  g auua  a 
5' cagcg  gc   gucg cggc ggg gag uaguagguuguauagu cu u    ca c
   |||||  ||   |||| |||| ||| ||| |||||||||||||||| || |    || a
3' guugc  cg   cagc gccg ccc uuc aucguccgauauguca ga a    gu c
        ag  aga    a    g   u   a                -  g --gg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670867: 81536-81651 [-]
intergenic
Database links

Mature sequence hme-let-7

Accession MIMAT0024931
Sequence

26 - 

ugagguaguagguuguauagua

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).