Stem-loop sequence hme-bantam

AccessionMI0021725 (change log)
DescriptionHeliconius melpomene bantam stem-loop
Gene family MIPF0000153; bantam
Stem-loop
         c                  ga    uuga 
5' acgaga ugguuuucauaaugauuu  caga    u
   |||||| ||||||||||||||||||  ||||    a
3' uguuuu aucgaaaguguuacuaga  gucu    c
         a                  --    uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE670669: 51607-51677 [+]
intergenic
Database links

Mature sequence hme-bantam

Accession MIMAT0024930
Sequence

45 - 

ugagaucauugugaaagcuaauu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).