Stem-loop sequence gma-MIR395m

AccessionMI0021719 (change log)
DescriptionGlycine max miR395m stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395m
(70 sentences)

Stem-loop
   cuuucuguu     uc   u          ug          g   uu    ag 
5'          gguug  ucu ggaguuccuc  aacgcuucau uga  ggcu  u
            |||||  ||| ||||||||||  |||||||||| |||  ||||  u
3'          ucaac  gga ucucaagggg  uugugaagua guu  ccgg  a
   ---------     uu   u          gu          -   -u    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 1774462-1774561 [+]
intergenic
Database links

Mature sequence gma-miR395m

Accession MIMAT0024925
Sequence

68 - 

augaaguguuugggggaacuc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).