Stem-loop sequence gma-MIR395l

AccessionMI0021718 (change log)
DescriptionGlycine max miR395l stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395l
(70 sentences)

Stem-loop
   uuuucu     cugu   uu          ug           uuagu     -----------     g     g a 
5'       guugg    ccu  ggaguuccuc  aacgcuucaug     gaggg           gggua ccagu u a
         |||||    |||  ||||||||||  |||||||||||     |||||           ||||| ||||| | a
3'       caacu    ggg  ucucaagggg  uugugaaguau     cuucc           cccau gguca g c
   -----u     ---u   -u          gu           ----u     gaauauuauua     -     g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 1760207-1760340 [+]
intergenic
Database links

Mature sequence gma-miR395l

Accession MIMAT0024924
Sequence

102 - 

augaaguguuugggggaacuc

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).