Stem-loop sequence gma-MIR395k

AccessionMI0021717 (change log)
DescriptionGlycine max miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395k
(70 sentences)

Stem-loop
   uugu   c   c              ug          a   --    -   - ----     a   a 
5'     ugg uga ucuuggaguuccuc  aacgcuucau uga  gagg cua c    cuagu aaa a
       ||| ||| ||||||||||||||  |||||||||| |||  |||| ||| |    ||||| ||| a
3'     auc acu agggccucaagggg  uugugaagua acu  uucc gau g    gauua uuu u
   ----   a   u              gu          -   uc    u   a aaau     c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 4835314-4835439 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395k
gma-MIR395achr1: 4840520-4840629 [+]
gma-MIR395kchr1: 4835314-4835439 [-]
gma-MIR395jchr1: 4832871-4832996 [-]
Database links

Mature sequence gma-miR395k

Accession MIMAT0024923
Sequence

93 - 

augaaguguuugggggaacuc

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).