Stem-loop sequence gma-MIR395j

AccessionMI0021716 (change log)
DescriptionGlycine max miR395j stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395j
(70 sentences)

Stem-loop
   ucuguu gc  uc   u          ug          guu       -------g     g   aug 
5'       g  ug  ccu ggaguuccuc  aacgcuucau   agugagg        gggua cca   u
         |  ||  ||| ||||||||||  ||||||||||   |||||||        ||||| |||    
3'       c  ac  ggg ucucaagggg  uugugaagua   uuauucc        cccau ggu   a
   -----u aa  uu   u          gu          -ac       gaauauua     -   caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 4832871-4832996 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395j
gma-MIR395achr1: 4840520-4840629 [+]
gma-MIR395kchr1: 4835314-4835439 [-]
gma-MIR395jchr1: 4832871-4832996 [-]
Database links

Mature sequence gma-miR395j

Accession MIMAT0024922
Sequence

93 - 

augaaguguuugggggaacuc

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).