Stem-loop sequence gma-MIR395i

AccessionMI0021715 (change log)
DescriptionGlycine max miR395i stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395i
(70 sentences)

Stem-loop
   cugu   c  uc   ugc        ug          g     --      caag    u 
5'     ugg ug  ucc   aguuccuc  aacgcuucau ugagg  ggcuag    ugua a
       ||| ||  |||   ||||||||  |||||||||| |||||  ||||||    |||| c
3'     acc ac  ggg   ucaagggg  uugugaagua acuuc  ccgauu    auau g
   ----   a  uc   uuc        gu          -     uu      --ua    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 4819957-4820072 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395i
gma-MIR395ichr1: 4819957-4820072 [-]
gma-MIR395hchr1: 4814429-4814541 [-]
Database links

Mature sequence gma-miR395i

Accession MIMAT0024921
Sequence

83 - 

augaaguguuugggggaacuc

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).