Stem-loop sequence gma-MIR395h

AccessionMI0021714 (change log)
DescriptionGlycine max miR395h stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395h
(70 sentences)

Stem-loop
   cugu   c  uc   u       cu ug          -gu    -    ---   uauu 
5'     ugg ug  ucc ggaguuc  c  aacgcuucau   gagg ggcu   agc    a
       ||| ||  ||| |||||||  |  ||||||||||   |||| ||||   |||     
3'     acc ac  ggg ucucaag  g  uugugaagua   uucu ccga   uug    u
   ----   a  uc   u       ag gu          acu    u    aua   caaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 4814429-4814541 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395h
gma-MIR395ichr1: 4819957-4820072 [-]
gma-MIR395hchr1: 4814429-4814541 [-]
Database links

Mature sequence gma-miR395h

Accession MIMAT0024920
Sequence

80 - 

augaaguguuugggagaacuc

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).