Stem-loop sequence gma-MIR394g

AccessionMI0021713 (change log)
DescriptionGlycine max miR394g stem-loop
Gene family MIPF0000100; MIR394
Literature search

8 open access papers mention gma-MIR394g
(12 sentences)

Stem-loop
   acagag   c      u c           -acuu u   cc 
5'       uuu uuggca u uguccaccucc     c ugg  c
         ||| |||||| | |||||||||||     | |||   
3'       aga aaccgu a auagguggagg     g auc  u
   -----g   u      c u           cucau c   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 1520278-1520357 [-]
intergenic
Database links

Mature sequence gma-miR394g

Accession MIMAT0024919
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).