Stem-loop sequence gma-MIR169v

AccessionMI0021699 (change log)
DescriptionGlycine max miR169v stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169v
(96 sentences)

Stem-loop
   caugua   c     ag             -   -------------      uuu    uu    aucaaguuuuaaaccgugguugcaguuucauugugauaaauugcggauaaaugcggccaaugugcagcauuuuggucacaguaacaccaaaa 
5'       aug agcca  gaugacuugccgg caa             gcuucu   ggca  guga                                                                                            a
         ||| |||||  ||||||||||||| |||             ||||||   ||||  ||||                                                                                             
3'       uac ucggu  cugcugaacggcc guu             ugaaga   ccgu  uauu                                                                                            u
   -ggaaa   a     cu             c   gaucaaugugaac      -uu    cg    acacguaaacucguauugauuacacuaauccagaaguguuaguuccaaaauuuuuggccagguguacaggacuaaaguuggugucguaguuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 15982021-15982322 [-]
intergenic
Database links

Mature sequence gma-miR169v

Accession MIMAT0024905
Sequence

10 - 

cagccaaggaugacuugcc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).