Stem-loop sequence gma-MIR166u

AccessionMI0021697 (change log)
DescriptionGlycine max miR166u stem-loop
Gene family MIPF0000004; MIR166
Literature search

37 open access papers mention gma-MIR166u
(220 sentences)

Stem-loop
   ga  u  a a      uu      cu     -   ---------  gagg      agaguacugagaugaguga 
5'   gg ug g ggaaug  gucugg  cgagg uca         ug    aggagg                   a
     || || | ||||||  ||||||  ||||| |||         ||    ||||||                    
3'   cc ac c ccuuac  cggacc  gcucu agu         ac    uucucc                   a
   -a  c  a c      uu      ag     u   uaaaaaaaa  acaa      cauuuaaagguaaccuuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 33862799-33862939 [+]
intergenic
Database links

Mature sequence gma-miR166u

Accession MIMAT0024903
Sequence

112 - 

ucucggaccaggcuucauuc

 - 131

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).