Stem-loop sequence gma-MIR166s

AccessionMI0021695 (change log)
DescriptionGlycine max miR166s stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166s
(293 sentences)

Stem-loop
   aau     u  --        uc    u  cu       ucuauaugauaugauguguccaugc 
5'    gaggg gu  ggggaaug  gccu gg  cgagaga                         a
      ||||| ||  ||||||||  |||| ||  |||||||                          
3'    cuccc ca  ccccuuac  cgga cc  gcucuuu                         u
   ---     u  cu        uu    -  ag       ugugaguguuugacuacuaaucacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 10246809-10246932 [+]
intergenic
Database links

Mature sequence gma-miR166s

Accession MIMAT0024901
Sequence

94 - 

ucggaccaggcuucauuccc

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).