Stem-loop sequence gma-MIR166r

AccessionMI0021694 (change log)
DescriptionGlycine max miR166r stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166r
(209 sentences)

Stem-loop
   cac  -c            c   g      a       gauauaucacuucaccauacucauaucuucacaaacucau 
5'    gu  uugaggggaaug agu uggucc aggagau                                        c
      ||  |||||||||||| ||| |||||| |||||||                                         
3'    ca  aacuucccuuac ucg accagg uccucug                                        a
   --a  uu            u   g      c       uauuauacguauauaauguuuaauaauaauguagacuuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
KQ474607.1: 1988-2142 [-]
intergenic
Database links

Mature sequence gma-miR166r

Accession MIMAT0024900
Sequence

126 - 

ucggaccaggcuucauuccc

 - 145

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).