Stem-loop sequence gma-MIR166q

AccessionMI0021693 (change log)
DescriptionGlycine max miR166q stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166q
(207 sentences)

Stem-loop
   u   a     a a      uu      cu     -    gaagauauacauaugaaaguguuaacuuuucaguuaa 
5'  guu gguug g ggaaug  gucugg  cgagg ucau                                     u
    ||| ||||| | ||||||  ||||||  ||||| ||||                                      
3'  caa ccgac c ccuuac  cggacc  gcucu agua                                     u
   a   -     c c      uu      ag     u    aaucccauauuuaauuaaagguaauuaaauaggaucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 47978878-47979029 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR166q
gma-MIR166echr4: 47978621-47978730 [+]
gma-MIR166qchr4: 47978878-47979029 [+]
Database links

Mature sequence gma-miR166q

Accession MIMAT0024899
Sequence

122 - 

ucggaccaggcuucauuccc

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).