Stem-loop sequence gma-MIR166p

AccessionMI0021692 (change log)
DescriptionGlycine max miR166p stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166p
(210 sentences)

Stem-loop
   aaa    g         uca              auucauuuauucaauuagucucaaac 
5'    aguu aggggaaug   ucugguucgagauc                          a
      |||| |||||||||   ||||||||||||||                          c
3'    ucga uccccuuac   ggaccaggcuuuag                          g
   -ua    g         uuc              uguguuuucuugacccaggcguaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 37501582-37501703 [-]
intergenic
Database links

Mature sequence gma-miR166p

Accession MIMAT0024898
Sequence

94 - 

ucggaccaggcuucauuccc

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).