Stem-loop sequence gma-MIR166o

AccessionMI0021691 (change log)
DescriptionGlycine max miR166o stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166o
(208 sentences)

Stem-loop
   au    a a      uu      cu     -    gauauggagauauauaugaaaguguuucaguuaaauu 
5'   guug g ggaaug  gucugg  cgagg ucau                                     c
     |||| | ||||||  ||||||  ||||| ||||                                     c
3'   cgac c ccuuac  cggacc  gcucu agua                                     a
   -c    c c      uu      ag     u    aaucccauauuuaauuaaagguaauuaaauauauggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 13019417-13019561 [-]
intergenic
Database links

Mature sequence gma-miR166o

Accession MIMAT0024897
Sequence

119 - 

ucggaccaggcuucauucccc

 - 139

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).