Stem-loop sequence gma-MIR166n

AccessionMI0021690 (change log)
DescriptionGlycine max miR166n stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166n
(208 sentences)

Stem-loop
   a   u a a      uu      cu     -    -------------ggagg      agaguacugagaucaguga 
5'  ggu g g ggaaug  gucugg  cgagg ucau                  aagagg                   a
    ||| | | ||||||  ||||||  ||||| ||||                  ||||||                    
3'  cca c c ccuuac  cggacc  gcucu agua                  uucucc                   a
   c   c - c      uu      ag     u    aaaaagacacacacacaa      cauuuaaagguaaccuuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 38037266-38037408 [-]
intergenic
Database links

Mature sequence gma-miR166n

Accession MIMAT0024896
Sequence

117 - 

ucggaccaggcuucauucccc

 - 137

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).